Basic Info

Gene ID OGI # | Score   Accession | Assembly | Annotation Location Links
OsLiXu_01g0013060 OGI:01032430 | 10/16 LIU XU | Os125827RS1 | Gramene(+IsoSeq) Chr01:10803715-10803924
Gene Symbol prx16, OsPOD1, POD1
DNA seq

ttaaattaccatgacaaagcaatcatggaaatgtaaacgaagcagcgctggggccatggaagggtcagcatcgatcaagccgtagacgacattgctgatcgtctgctcggcatttgggcacgacgatccgtagaaattgtactgcagacttgcagttgatatggagatgaggctcatagcctggaaggctaccatgagaattagcttcat

CDS seq

atgaagctaattctcatggtagccttccaggctatgagcctcatctccatatcaactgcaagtctgcagtacaatttctacggatcgtcgtgcccaaatgccgagcagacgatcagcaatgtcgtctacggcttgatcgatgctgacccttccatggccccagcgctgcttcgtttacatttccatgattgctttgtcatggtaatttaa

Protein seq

MKLILMVAFQAMSLISISTASLQYNFYGSSCPNAEQTISNVVYGLIDADPSMAPALLRLHFHDCFVMVI

Function Peroxidase 30 [UniProtKB/Swiss-Prot:Q9LSY7]

Transcripts

Gene Transcript Chromosome Start End Strand Source
OsLiXu_01g0013060 OsLiXu_01g0013060.01 Chr01 10803715 10803924 - NAM
CDS seq

atgaagctaattctcatggtagccttccaggctatgagcctcatctccatatcaactgcaagtctgcagtacaatttctacggatcgtcgtgcccaaatgccgagcagacgatcagcaatgtcgtctacggcttgatcgatgctgacccttccatggccccagcgctgcttcgtttacatttccatgattgctttgtcatggtaatttaa

More
Protein seq

MKLILMVAFQAMSLISISTASLQYNFYGSSCPNAEQTISNVVYGLIDADPSMAPALLRLHFHDCFVMVI

Event Type Chromosome Start End Strand Alternative mRNAs Total mRNAs Source

Expression

Leaf Root Panicle
FPKM 0.0 1.005049 0.0

Homologues

Genome & Annotation Homologs Type Expression(FPKM)
Leaf Root Panicle
Nipponbare | IRGSP 1.0 | Gramene(+IsoSeq) OsNip_01g0327100 SBH 5.273015 7.575571 14.638708
Nipponbare | IRGSP 1.0 | MSU LOC_Os01g18910 RBH 0.0 0.0 0.0
Nipponbare | IRGSP 1.0 | RAP-db Os01g0327100 SBH None None None
Azucena | AzucenaRS1 | Gramene(+IsoSeq) OsAzu_01g0013360 RBH 0.0 0.0 0.0
KETAN NANGKA | Os128077RS1 | Gramene(+IsoSeq) OsKeNa_01g0013110 RBH 0.0 0.0 0.0
CHAO MEO | Os132278RS1 | Gramene(+IsoSeq) OsCMeo_01g0013380 RBH 0.000000 0.000000 0.243327
ARC 10497 | Os117425RS1 | Gramene(+IsoSeq) OsARC_01g0012860 RBH 0.0 0.732414 None
PR 106 | Os127742RS1 | Gramene(+IsoSeq) OsPr106_01g0012970 RBH 0.0 0.0 0.0
Minghui 63 | MH63RS3 | HZAU OsMH63_01G0177200 RBH 0.0272225 0.1674925 0.158645
IR 64 | OsIR64RS1 | Gramene(+IsoSeq) OsIR64_01g0012910 RBH 0.306652 4.224185 0.0
Zhenshan 97 | ZS97RS3 | HZAU OsZS97_01G0176400 RBH 0.024655 0.176975 0.309878
LIMA | Os127564RS1 | Gramene(+IsoSeq) OsLima_01g0012900 RBH 0.0 0.0 None
KHAO YAI GUANG | Os127518RS1 | Gramene(+IsoSeq) OsKYG_01g0013000 RBH 0.0 0.0 None
GOBOL SAIL | Os132424RS1 | Gramene(+IsoSeq) OsGoSa_01g0012960 RBH 0.0 0.0 None
LIU XU | Os125827RS1 | Gramene(+IsoSeq) OsLiXu_05g0002600 RBH 2.021781 8.018285 6.478323
LARHA MUGAD | Os125619RS1 | Gramene(+IsoSeq) OsLaMu_01g0012750 RBH 0.0 0.000000 None
N22 | OsN22RS2 | Gramene(+IsoSeq) OsN22_01G013050 RBH 0.0 1.806657 0.0
NATEL BORO | Os127652RS1 | Gramene(+IsoSeq) OsNaBo_01g0012810 RBH 0.0 0.0 0.0
Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.