Basic Info

Gene ID OGI # | Score   Accession | Assembly | Annotation Location Links
OsLima_11g0006670 OGI:11015600 | 12/16 LIMA | Os127564RS1 | Gramene(+IsoSeq) Chr11:5473025-5473612
Gene Symbol -
DNA seq

atgagagtcatgttaggcagctcgacccaatcgatcaaactgattcgtagcacccgagcttggcagcgcaaagctcgctggatccagcggacgaagagctgctctttttcaggcaagaactccgggaaattgatgttgatactgcagtaattcagaggcgcgctgctgctgcggagcgtaaaaaagcggtccaccaagctgatgaacctgtcgcccggttcatcgtaatcccaccactccacagagaggcccggtgcttccttccagaggtggagccagcgccgggcgagcacgcacgtcgccaccgcgtcgtgcaccgggagcagcgacagcacgaggtggagcacctcgtccggcagggcgctgatgcggtccggtgccactcgctccttcttcttcctccccctcgccgccgccaccgccttcctcttccggggagccaggggaggcattccgtcgaacggttgccgcgcgtgtgggtggaagtggaagcgcggcgtcgcctcggctccgccgaatggcaccgaaatgcagccgcgcgcgcgcgtcgaacgccggaacggcagcgagatggagtctgggagatga

More
CDS seq

atgagagtcatgttaggcagctcgacccaatcgatcaaactgattcgtagcacccgagcttggcagcgcaaagctcgctggatccagcggacgaagagctgctctttttcaggcaagaactccgggaaattgatgttgatactgcaaggcgcgctgctgctgcggagcgtaaaaaagcggtccaccaagctgatgaacctgtcgcccgagaggcccggtgcttccttccagaggtggagccagcgccgggcgagcacgcacgtcgccaccgcgtcgtgcaccgggagcagcgacagcacgaggtggagcacctcgtccggcagggcgctgatgcggtccggtgccactcgctccttcttcttcctccccctcgccgccgccaccgccttcctcttccggggagccaggggaggcattccgtcgaacggttgccgcgcgtgtgggtggaagtggaagcgcggcgtcgcctcggctccgccgaatggcaccgaaatgcagccgcgcgcgcgcgtcgaacgccggaacggcagcgagatggagtctgggagatga

More
Protein seq

MRVMLGSSTQSIKLIRSTRAWQRKARWIQRTKSCSFSGKNSGKLMLILQGALLLRSVKKRSTKLMNLSPERPGASFQRWSQRRASTHVATASCTGSSDSTRWSTSSGRALMRSGATRSFFFLPLAAATAFLFRGARGGIPSNGCRACGWKWKRGVASAPPNGTEMQPRARVERRNGSEMESGR

Function -

Transcripts

Gene Transcript Chromosome Start End Strand Source
OsLima_11g0006670 OsLima_11g0006670.01 Chr11 5473025 5473612 + NAM
CDS seq

atgagagtcatgttaggcagctcgacccaatcgatcaaactgattcgtagcacccgagcttggcagcgcaaagctcgctggatccagcggacgaagagctgctctttttcaggcaagaactccgggaaattgatgttgatactgcaaggcgcgctgctgctgcggagcgtaaaaaagcggtccaccaagctgatgaacctgtcgcccgagaggcccggtgcttccttccagaggtggagccagcgccgggcgagcacgcacgtcgccaccgcgtcgtgcaccgggagcagcgacagcacgaggtggagcacctcgtccggcagggcgctgatgcggtccggtgccactcgctccttcttcttcctccccctcgccgccgccaccgccttcctcttccggggagccaggggaggcattccgtcgaacggttgccgcgcgtgtgggtggaagtggaagcgcggcgtcgcctcggctccgccgaatggcaccgaaatgcagccgcgcgcgcgcgtcgaacgccggaacggcagcgagatggagtctgggagatga

More
Protein seq

MRVMLGSSTQSIKLIRSTRAWQRKARWIQRTKSCSFSGKNSGKLMLILQGALLLRSVKKRSTKLMNLSPERPGASFQRWSQRRASTHVATASCTGSSDSTRWSTSSGRALMRSGATRSFFFLPLAAATAFLFRGARGGIPSNGCRACGWKWKRGVASAPPNGTEMQPRARVERRNGSEMESGR

Event Type Chromosome Start End Strand Alternative mRNAs Total mRNAs Source

Expression

Leaf Root Panicle
FPKM 0.0 0.0 None

Homologues

Genome & Annotation Homologs Type Expression(FPKM)
Leaf Root Panicle
Nipponbare | IRGSP 1.0 | Gramene(+IsoSeq) OsNip_11g0202100 RBH 0.000000 0.174744 0.000000
Nipponbare | IRGSP 1.0 | MSU LOC_Os11g09684 RBH 0.000000 0.0 0.0
Nipponbare | IRGSP 1.0 | RAP-db Os11g0202100 RBH None None None
Azucena | AzucenaRS1 | Gramene(+IsoSeq) OsAzu_11g0006870 RBH 0.0 0.0 0.000000
KETAN NANGKA | Os128077RS1 | Gramene(+IsoSeq) OsKeNa_11g0006810 RBH 0.0 0.0 0.000000
CHAO MEO | Os132278RS1 | Gramene(+IsoSeq) NA NA NA NA NA
ARC 10497 | Os117425RS1 | Gramene(+IsoSeq) OsARC_11g0006720 RBH 0.0 0.0 None
PR 106 | Os127742RS1 | Gramene(+IsoSeq) OsPr106_11g0006690 RBH 0.000000 0.0 0.0
Minghui 63 | MH63RS3 | HZAU NA NA NA NA NA
IR 64 | OsIR64RS1 | Gramene(+IsoSeq) NA NA NA NA NA
Zhenshan 97 | ZS97RS3 | HZAU NA NA NA NA NA
LIMA | Os127564RS1 | Gramene(+IsoSeq) OsLima_11g0006340 RBH 0.000000 0.000000 None
KHAO YAI GUANG | Os127518RS1 | Gramene(+IsoSeq) NA NA NA NA NA
GOBOL SAIL | Os132424RS1 | Gramene(+IsoSeq) OsGoSa_11g0006760 RBH 0.0 0.000000 None
LIU XU | Os125827RS1 | Gramene(+IsoSeq) OsLiXu_11g0006430 SBH 0.000000 0.0 0.000000
LARHA MUGAD | Os125619RS1 | Gramene(+IsoSeq) OsLaMu_11g0006820 RBH 0.0 0.000000 None
N22 | OsN22RS2 | Gramene(+IsoSeq) OsN22_11G006790 RBH 0.000000 0.000000 0.000000
NATEL BORO | Os127652RS1 | Gramene(+IsoSeq) OsNaBo_11g0006620 RBH 0.000000 0.000000 0.000000
Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.