Basic Info

Gene ID OGI # | Score   Accession | Assembly | Annotation Location Links
OsKeNa_06g0025460 OGI:06077620 | 12/16 KETAN NANGKA | Os128077RS1 | Gramene(+IsoSeq) Chr06:28372512-28373882
Gene Symbol -
DNA seq

tcacacaacaaatttgcatactgaagaagataaaaaaaaaagttcgatagattcatcgctcatactagcaagcatggcaatgccagttggagttgcaccggtgttgttactgttgcttttgccattggcggcggcgacggcggcggcggagagtgacgacagggacgcgctgatggcgttcaaggccggcgtgacgtcggacccgaccggcgtgctccggtcgtggaacgagacggtgcacttctgccggtggccgggggtgaactgcacggcggggcgcgtcacgtcgctggacgtgtccatgggccgcctcgccggcgagctctcgccggccgtcgccaacctcacgcggctcgtggtgctcaacctcacctccaacgccttctccgggagcatccccggcggcctcggccggctccggcggatgcggtacctcagcctctgcgacaacgcgttcgccggcgagatacccgacgcgctccgcaactgcaccgccctcgccgtcgcgtacctcaacaacaacaacctcgtcggcggcgtcccacggtggctcggcgcgctgcccaacctcgccgtgctccggctcagccacaactcgctctccggccgcatcccgccgtcgctggcgaacctgacgaagatctttcggctcgagctcgaccagaaccttctggaaggttccatccccgacggcttgtcgcgcctcccggcgctcggcatgttagccttgtcgcagaacagcctcgccggagagatcccggtggggttcttcaacatgacgtcgctgcgtggcctcgcgctcgccgacaacgcgttccgcggcgagctcccgggcgacgcgggcgcgcgcacgccgaacctccagtacctcttcctcggcggcaacctcctcgccggcccgatctcggcgtcgctgtcgaacgccacggcgctggtggctctcagcctcgcgaacaacagcttcgccgggcaggtgcccggcgagatcggcacgctctgcccgctgtcgctggagctgtcgaacaaccagctcacggcgaccgacgacgccggcggcggctgggagttcatggacaacctgaccaactgcagcgccttggccgagatactcctcgacggcaacaagttcgccggcgtgatgccgccctccgtcgtccgcctctcgccgcagctcgaggcgctgaaccttgccggcaaccgcatatccggcgtaataccgccggagatcgagagcctcgtcgggctgcaaacgttgtgcctccagtccaatctcttctccggcgagatcccggaagcgatcggcaagctcaagaaccttcgagagctgctgctagagcagaacgaactggccgggccggtgccatccgccat

More
CDS seq

atggcggatggcaccggcccggccagttcgttctgctctagcagcagctctcgaaggttcttgagcttgccgatcgcttccgggatctcgccggagaagagattggactggaggcacaacgtttgcagcccgacgaggctctcgatctccggcggtattacgccggatatgcggttgccggcaaggttcagcgcctcgagctgcggcgagaggcggacgacggagggcggcatcacgccggcgaacttgttgccgtcgaggagtatctcggccaaggcgctgcagttggtcaggttgtccatgaactcccagccgccgccggcgtcgtcggtcgccgtgagctggttgttcgacagctccagcgacagcgggcagagcgtgccgatctcgccgggcacctgcccggcgaagctgttgttcgcgaggctgagagccaccagcgccgtggcgttcgacagcgacgccgagatcgggccggcgaggaggttgccgccgaggaagaggtactggaggttcggcgtgcgcgcgcccgcgtcgcccgggagctcgccgcggaacgcgttgtcggcgagcgcgaggccacgcagcgacgtcatgttgaagaaccccaccgggatctctccggcgaggctgttctgcgacaaggctaacatgccgagcgccgggaggcgcgacaagccgtcggggatggaaccttccagaaggttctggtcgagctcgagccgaaagatcttcgtcaggttcgccagcgacggcgggatgcggccggagagcgagttgtggctgagccggagcacggcgaggttgggcagcgcgccgagccaccgtgggacgccgccgacgaggttgttgttgttgaggtacgcgacggcgagggcggtgcagttgcggagcgcgtcgggtatctcgccggcgaacgcgttgtcgcagaggctgaggtaccgcatccgccggagccggccgaggccgccggggatgctcccggagaaggcgttggaggtgaggttgagcaccacgagccgcgtgaggttggcgacggccggcgagagctcgccggcgaggcggcccatggacacgtccagcgacgtgacgcgccccgccgtgcagttcacccccggccaccggcagaagtgcaccgtctcgttccacgaccggagcacgccggtcgggtccgacgtcacgccggccttgaacgccatcagcgcgtccctgtcgtcactctccgccgccgccgtcgccgccgccaatggcaaaagcaacagtaacaacaccggtgcaactccaactggcattgccatgcttgctatatgcaaatttgttgtgtga

More
Protein seq

MADGTGPASSFCSSSSSRRFLSLPIASGISPEKRLDWRHNVCSPTRLSISGGITPDMRLPARFSASSCGERRTTEGGITPANLLPSRSISAKALQLVRLSMNSQPPPASSVAVSWLFDSSSDSGQSVPISPGTCPAKLLFARLRATSAVAFDSDAEIGPARRLPPRKRYWRFGVRAPASPGSSPRNALSASARPRSDVMLKNPTGISPARLFCDKANMPSAGRRDKPSGMEPSRRFWSSSSRKIFVRFASDGGMRPESELWLSRSTARLGSAPSHRGTPPTRLLLLRYATARAVQLRSASGISPANALSQRLRYRIRRSRPRPPGMLPEKALEVRLSTTSRVRLATAGESSPARRPMDTSSDVTRPAVQFTPGHRQKCTVSFHDRSTPVGSDVTPALNAISASLSSLSAAAVAAANGKSNSNNTGATPTGIAMLAICKFVV

Function -

Transcripts

Gene Transcript Chromosome Start End Strand Source
OsKeNa_06g0025460 OsKeNa_06g0025460.01 Chr06 28372512 28373882 - NAM
CDS seq

atggcggatggcaccggcccggccagttcgttctgctctagcagcagctctcgaaggttcttgagcttgccgatcgcttccgggatctcgccggagaagagattggactggaggcacaacgtttgcagcccgacgaggctctcgatctccggcggtattacgccggatatgcggttgccggcaaggttcagcgcctcgagctgcggcgagaggcggacgacggagggcggcatcacgccggcgaacttgttgccgtcgaggagtatctcggccaaggcgctgcagttggtcaggttgtccatgaactcccagccgccgccggcgtcgtcggtcgccgtgagctggttgttcgacagctccagcgacagcgggcagagcgtgccgatctcgccgggcacctgcccggcgaagctgttgttcgcgaggctgagagccaccagcgccgtggcgttcgacagcgacgccgagatcgggccggcgaggaggttgccgccgaggaagaggtactggaggttcggcgtgcgcgcgcccgcgtcgcccgggagctcgccgcggaacgcgttgtcggcgagcgcgaggccacgcagcgacgtcatgttgaagaaccccaccgggatctctccggcgaggctgttctgcgacaaggctaacatgccgagcgccgggaggcgcgacaagccgtcggggatggaaccttccagaaggttctggtcgagctcgagccgaaagatcttcgtcaggttcgccagcgacggcgggatgcggccggagagcgagttgtggctgagccggagcacggcgaggttgggcagcgcgccgagccaccgtgggacgccgccgacgaggttgttgttgttgaggtacgcgacggcgagggcggtgcagttgcggagcgcgtcgggtatctcgccggcgaacgcgttgtcgcagaggctgaggtaccgcatccgccggagccggccgaggccgccggggatgctcccggagaaggcgttggaggtgaggttgagcaccacgagccgcgtgaggttggcgacggccggcgagagctcgccggcgaggcggcccatggacacgtccagcgacgtgacgcgccccgccgtgcagttcacccccggccaccggcagaagtgcaccgtctcgttccacgaccggagcacgccggtcgggtccgacgtcacgccggccttgaacgccatcagcgcgtccctgtcgtcactctccgccgccgccgtcgccgccgccaatggcaaaagcaacagtaacaacaccggtgcaactccaactggcattgccatgcttgctatatgcaaatttgttgtgtga

More
Protein seq

MADGTGPASSFCSSSSSRRFLSLPIASGISPEKRLDWRHNVCSPTRLSISGGITPDMRLPARFSASSCGERRTTEGGITPANLLPSRSISAKALQLVRLSMNSQPPPASSVAVSWLFDSSSDSGQSVPISPGTCPAKLLFARLRATSAVAFDSDAEIGPARRLPPRKRYWRFGVRAPASPGSSPRNALSASARPRSDVMLKNPTGISPARLFCDKANMPSAGRRDKPSGMEPSRRFWSSSSRKIFVRFASDGGMRPESELWLSRSTARLGSAPSHRGTPPTRLLLLRYATARAVQLRSASGISPANALSQRLRYRIRRSRPRPPGMLPEKALEVRLSTTSRVRLATAGESSPARRPMDTSSDVTRPAVQFTPGHRQKCTVSFHDRSTPVGSDVTPALNAISASLSSLSAAAVAAANGKSNSNNTGATPTGIAMLAICKFVV

More
Event Type Chromosome Start End Strand Alternative mRNAs Total mRNAs Source

Expression

Leaf Root Panicle
FPKM 0.0 0.000000 0.0

Homologues

Genome & Annotation Homologs Type Expression(FPKM)
Leaf Root Panicle
Nipponbare | IRGSP 1.0 | Gramene(+IsoSeq) NA NA NA NA NA
Nipponbare | IRGSP 1.0 | MSU LOC_Os06g44630 SBH 0.0 0.0 0.0
Nipponbare | IRGSP 1.0 | RAP-db NA NA NA NA NA
Azucena | AzucenaRS1 | Gramene(+IsoSeq) OsAzu_06g0025650 RBH 0.134394 0.0 0.0
KETAN NANGKA | Os128077RS1 | Gramene(+IsoSeq) NA NA NA NA NA
CHAO MEO | Os132278RS1 | Gramene(+IsoSeq) OsCMeo_06g0025650 RBH 0.0 0.0 0.0
ARC 10497 | Os117425RS1 | Gramene(+IsoSeq) OsARC_06g0025240 RBH 0.0 0.0 None
PR 106 | Os127742RS1 | Gramene(+IsoSeq) OsPr106_06g0025720 RBH 0.0 0.0 0.0
Minghui 63 | MH63RS3 | HZAU OsMH63_06G0422100 SBH 0 0.04038 0
IR 64 | OsIR64RS1 | Gramene(+IsoSeq) OsIR64_06g0025210 RBH 0.0 0.0 0.0
Zhenshan 97 | ZS97RS3 | HZAU OsZS97_06G0415700 RBH 0.280241 1.229753 0.0375575
LIMA | Os127564RS1 | Gramene(+IsoSeq) OsLima_06g0025590 RBH 0.0 0.0 None
KHAO YAI GUANG | Os127518RS1 | Gramene(+IsoSeq) OsKYG_06g0025610 RBH 0.000000 0.0 None
GOBOL SAIL | Os132424RS1 | Gramene(+IsoSeq) OsGoSa_06g0025260 RBH 0.000000 0.0 None
LIU XU | Os125827RS1 | Gramene(+IsoSeq) OsLiXu_06g0025860 RBH 0.000000 0.0 0.0
LARHA MUGAD | Os125619RS1 | Gramene(+IsoSeq) OsLaMu_06g0025510 RBH 0.000000 0.0 None
N22 | OsN22RS2 | Gramene(+IsoSeq) OsN22_06G024560 SBH 0.0 0.0 0.000000
NATEL BORO | Os127652RS1 | Gramene(+IsoSeq) OsNaBo_06g0024700 SBH 0.0 0.0 0.0
Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.