Rice Gene Index: a comprehensive database for homology, collinearity, and transcripts of genes in rice pangenome.

Variation ID: OglaRS2_Y3551_OTH0157460

Variant Type:

Ref Genome:

Query Genome:

Chromosome:

Ref Start:

Ref End:

OTH

Os O.glaberrima: OglaRS2 | OglaRS2

Os XI-1B: Y3551 | Y3551

Chr01

33642067

33642138

SV Length:

Query Start:

Query End:

Allele sv Count:

290 bp

37968429

37968718

20

Gene_id	Chromosome	Start	End
OsY3551G0101406600.01	Chr01	37960282	37969958

SV_id	Chromosome	ref_start	ref_end	query_start	query_end	length
OglaRS2_125827_OTH0156410	Chr01	33642067	33642138	38390549	38390838	290
OglaRS2_127518_OTH0157140	Chr01	33642067	33642138	38360489	38360778	290
OglaRS2_127564_OTH0154930	Chr01	33642067	33642138	38305725	38306014	290
OglaRS2_127742_OTH0157200	Chr01	33642067	33642138	37860971	37861260	290
OglaRS2_132424_OTH0156290	Chr01	33642067	33642138	37981577	37981866	290
OglaRS2_D62_OTH0155530	Chr01	33642067	33642138	37793267	37793556	290
OglaRS2_FH838_OTH0157980	Chr01	33642067	33642138	38351206	38351495	290
OglaRS2_G630_OTH0157810	Chr01	33642067	33642138	38273962	38274251	290
OglaRS2_HZ_OTH0157700	Chr01	33642067	33642138	38339563	38339852	290
OglaRS2_IR64_OTH0157460	Chr01	33642067	33642138	37907582	37907871	290
OglaRS2_J4155_OTH0156230	Chr01	33642067	33642138	38145181	38145470	290
OglaRS2_J4155S_OTH0156820	Chr01	33642067	33642138	38621762	38622051	290
OglaRS2_Lemont_OTH0155410	Chr01	33642067	33642138	37755439	37755728	290
OglaRS2_R498_OTH0157180	Chr01	33642067	33642138	37725980	37726269	290
OglaRS2_R527_OTH0157340	Chr01	33642067	33642138	37929059	37929348	290
OglaRS2_S548_OTH0156230	Chr01	33642067	33642138	37609488	37609777	290
OglaRS2_WSSM_OTH0156250	Chr01	33642067	33642138	37858337	37858626	290
OglaRS2_Y3551_OTH0157460	Chr01	33642067	33642138	37968429	37968718	290
OglaRS2_Y58S_OTH0155090	Chr01	33642067	33642138	37082250	37082539	290
OglaRS2_MH63RS3_OTH0158090	Chr01	33642067	33642138	38545459	38545748	290

>OglaRS2_Y3551_OTH0157460
AAGAAGATGAGATAAGAGATGAGCCACACGCCAATATCTAGTTGGATATGCAGGAGTTCGGCTGAGAGCGTTCCCAGCGCGCACAGTAAACACGGAAAACGGAGCGGTCATTAGCGCGTGATTAATTAAGTATTAGCTAATTTTTTTTAAAAAAATGGATTAATTTGATTTTTTTTAAACAACTTTTGTATAGAAACTTTTTGCAAAAAAATGCACCGTGTAGTAGTTTGAAAAGCGTGCGCGGACGAAAAGTTACTGTGCACGCCGGGAAAACAGCTGCCGAACACAGC