Variation ID: OglaRS2_Y3551_OTH0157460

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
290 bp
37968429
37968718
20
Gene_id Chromosome Start End
OsY3551G0101406600.01 Chr01 37960282 37969958
SV_id Chromosome ref_start ref_end query_start query_end length
OglaRS2_125827_OTH0156410 Chr01 33642067 33642138 38390549 38390838 290
OglaRS2_127518_OTH0157140 Chr01 33642067 33642138 38360489 38360778 290
OglaRS2_127564_OTH0154930 Chr01 33642067 33642138 38305725 38306014 290
OglaRS2_127742_OTH0157200 Chr01 33642067 33642138 37860971 37861260 290
OglaRS2_132424_OTH0156290 Chr01 33642067 33642138 37981577 37981866 290
OglaRS2_D62_OTH0155530 Chr01 33642067 33642138 37793267 37793556 290
OglaRS2_FH838_OTH0157980 Chr01 33642067 33642138 38351206 38351495 290
OglaRS2_G630_OTH0157810 Chr01 33642067 33642138 38273962 38274251 290
OglaRS2_HZ_OTH0157700 Chr01 33642067 33642138 38339563 38339852 290
OglaRS2_IR64_OTH0157460 Chr01 33642067 33642138 37907582 37907871 290
OglaRS2_J4155_OTH0156230 Chr01 33642067 33642138 38145181 38145470 290
OglaRS2_J4155S_OTH0156820 Chr01 33642067 33642138 38621762 38622051 290
OglaRS2_Lemont_OTH0155410 Chr01 33642067 33642138 37755439 37755728 290
OglaRS2_R498_OTH0157180 Chr01 33642067 33642138 37725980 37726269 290
OglaRS2_R527_OTH0157340 Chr01 33642067 33642138 37929059 37929348 290
OglaRS2_S548_OTH0156230 Chr01 33642067 33642138 37609488 37609777 290
OglaRS2_WSSM_OTH0156250 Chr01 33642067 33642138 37858337 37858626 290
OglaRS2_Y3551_OTH0157460 Chr01 33642067 33642138 37968429 37968718 290
OglaRS2_Y58S_OTH0155090 Chr01 33642067 33642138 37082250 37082539 290
OglaRS2_MH63RS3_OTH0158090 Chr01 33642067 33642138 38545459 38545748 290

>OglaRS2_Y3551_OTH0157460
AAGAAGATGAGATAAGAGATGAGCCACACGCCAATATCTAGTTGGATATGCAGGAGTTCGGCTGAGAGCGTTCCCAGCGCGCACAGTAAACACGGAAAACGGAGCGGTCATTAGCGCGTGATTAATTAAGTATTAGCTAATTTTTTTTAAAAAAATGGATTAATTTGATTTTTTTTAAACAACTTTTGTATAGAAACTTTTTGCAAAAAAATGCACCGTGTAGTAGTTTGAAAAGCGTGCGCGGACGAAAAGTTACTGTGCACGCCGGGAAAACAGCTGCCGAACACAGC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.