Variation ID: Lemont_R527_INS0434090

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
319 bp
28383602
28383920
5
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
Lemont_117534_INS0441410 Chr04 16819688 16820011 26890713 26891035 323
Lemont_127742_INS0438370 Chr04 16819688 16820011 28910757 28911075 319
Lemont_HZ_INS0437750 Chr04 16819688 16820011 29082424 29082742 319
Lemont_R527_INS0434090 Chr04 16819688 16820011 28383602 28383920 319
Lemont_S548_INS0433800 Chr04 16819688 16826678 32462829 32469804 6976

>Lemont_R527_INS0434090
TGTAGCGCCCGTTCCGTCGTGGCGCCTAGCGGGAAAATTATCTCTTAAAAACCCTAATTGCGAAATTTGTTTCTTTGCTTGTTGTCTAGTGTCCGTGCCATCTCAAGATCTCAAATCCCCGATATATCGTCGAGTTCAATTCCGAATCTAAATCCTTCCAAATCAAATCCCTCCGCAAAAGTCTATTTTGCCTCCCCCGGGGTCGATGGGCCGAATCTCTTTCGGCCCATCTCCCCCTCCCTCTCGGCGCTCTCTCTCTCTCTCTCTCTCTCTCTCCCTCTCTCCCTTCCCCTCGCTCTGCCCGCGCGTGCGCGAGCGC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.