Variation ID: Kosh_125827_INS0453100

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
282 bp
33752960
33753241
18
Gene_id Chromosome Start End
OsLiXu_04g0026990 Chr04 33728991 33757141
SV_id Chromosome ref_start ref_end query_start query_end length
Kosh_125827_INS0453100 Chr04 22790528 22790813 33752960 33753241 282
Kosh_125827_INS0453100_1 Chr04 22790528 22794479 29657890 29661768 3879
Kosh_127518_INS0453990 Chr04 22790528 22794479 28880930 28884809 3880
Kosh_127564_INS0456180 Chr04 22790528 22794479 29157054 29160933 3880
Kosh_CN1_INS0453040 Chr04 22790528 22794479 28308027 28311905 3879
Kosh_D62_INS0453760 Chr04 22790528 22794479 28340582 28344462 3881
Kosh_DG_INS0454620 Chr04 22790528 22794479 28727461 28731339 3879
Kosh_FH838_INS0450170 Chr04 22790528 22794479 28797191 28801069 3879
Kosh_FS32_INS0449260 Chr04 22790528 22794479 28420266 28424144 3879
Kosh_G46_INS0450680 Chr04 22790528 22794479 27886940 27890818 3879
Kosh_G630_INS0450460 Chr04 22790528 22794479 28922502 28926380 3879
Kosh_II32_INS0450150 Chr04 22790528 22794479 28839351 28843229 3879
Kosh_LK638S_INS0453020 Chr04 22790528 22794479 28837617 28841498 3882
Kosh_TM_INS0451990 Chr04 22790528 22794479 27029296 27033174 3879
Kosh_Tumba_INS0455400 Chr04 22790528 22794479 29350371 29354248 3878
Kosh_Y3551_INS0451610 Chr04 22790528 22794479 29144065 29147944 3880
Kosh_ZS97RS3_INS0451080 Chr04 22790528 22794479 29178690 29182568 3879
Kosh_MH63RS3_INS0450730 Chr04 22790528 22794479 29403750 29407628 3879

>Kosh_125827_INS0453100
gagagagagagagagagagagagagagagagagagcgccgggagggagggggagatgggccgagagggattcggcccatcgaccccgggggaggcaaaatagacttttgcggagggatttgatttggaaggatttggattcggaaatggactcgacgatagatcggggattgagatccgggatggcacggacactagacaacaagcaaggaaacaaatttcgcaattagggtttttaagagataattttcccgctaggcgccacgacggaacgggcgctaca

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.