Variation ID: FS32_127742_INS1115980

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
333 bp
13367349
13367681
31
Gene_id Chromosome Start End
OsPr106_11g0011760 Chr11 13365341 13371657
SV_id Chromosome ref_start ref_end query_start query_end length
FS32_117534_INS1117780 Chr11 12628927 12628927 12715081 12715413 333
FS32_125619_INS1111870 Chr11 12628927 12628927 12682497 12682165 333
FS32_125827_INS1114930 Chr11 12628927 12628927 13688045 13688377 333
FS32_127564_INS1115830 Chr11 12628927 12628927 12542506 12542174 333
FS32_127652_INS1119630 Chr11 12628927 12628927 12514874 12514542 333
FS32_127742_INS1115980 Chr11 12628927 12628927 13367349 13367681 333
FS32_132424_INS1113390 Chr11 12628927 12628927 12599577 12599245 333
FS32_CN1_INS1108330 Chr11 12628927 12628927 14184371 14184703 333
FS32_DG_INS1108620 Chr11 12628927 12628927 14771557 14771889 333
FS32_FH838_INS1114750 Chr11 12628927 12628927 14374408 14374740 333
FS32_G46_INS1110770 Chr11 12628927 12628927 13222795 13223127 333
FS32_G630_INS1117110 Chr11 12628927 12628927 13625735 13626067 333
FS32_G8_INS1111680 Chr11 12628927 12628927 12706738 12707070 333
FS32_HZ_INS1113210 Chr11 12628927 12628927 13135737 13135405 333
FS32_II32_INS1109450 Chr11 12628927 12628927 14243828 14243496 333
FS32_IR64_INS1113990 Chr11 12628927 12628927 12715272 12715604 333
FS32_J4155_INS1113630 Chr11 12628927 12628927 12499255 12498923 333
FS32_J4155S_INS1113590 Chr11 12628927 12628927 13149976 13149644 333
FS32_LK638S_INS1112880 Chr11 12628927 12628927 13182026 13181694 333
FS32_R498_INS1115660 Chr11 12628927 12628927 13118906 13119238 333
FS32_R9311_INS1117050 Chr11 12628927 12628927 13297371 13297703 333
FS32_S548_INS1114290 Chr11 12628927 12628927 13320119 13320451 333
FS32_TM_INS1115310 Chr11 12628927 12628927 14098499 14098831 333
FS32_Tumba_INS1114640 Chr11 12628927 12628927 13151286 13151618 333
FS32_WSSM_INS1114970 Chr11 12628927 12628927 12924095 12924427 333
FS32_XL628S_INS1112640 Chr11 12628927 12628927 13176114 13175782 333
FS32_Y3551_INS1115810 Chr11 12628927 12628927 12995459 12995127 333
FS32_Y58S_INS1121570 Chr11 12628927 12628927 13881967 13881635 333
FS32_YX1_INS1115330 Chr11 12628927 12628927 12888813 12889145 333
FS32_ZS97RS3_INS1109500 Chr11 12628927 12628927 13282788 13282456 333
FS32_MH63RS3_INS1117730 Chr11 12628927 12628927 13398919 13399251 333

>FS32_127742_INS1115980
tttgtagggagtaccatcactattttctgatcttagcccattgtatgagcaacctggcaaggtaatagcagttatgcttctcaaaatcattttttgtacttctttttctctgttgtagcatgatctttcagattgccctacataatgtttattttttatacctatagccatattgattacttcagatttgacatggaaaaatgtgaaatatttaaaagaactcagattcagtcagaactattgtgtaagcatgcatagaaagctaccctaaatagacttgatgcccatttgtcaagtacagcctacatgtgaagtaatctaatacaagcagtt

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.