Variation ID: 128077_127742_INS1122180

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
333 bp
13367349
13367681
33
Gene_id Chromosome Start End
OsPr106_11g0011760 Chr11 13365341 13371657
SV_id Chromosome ref_start ref_end query_start query_end length
128077_117534_INS1118590 Chr11 12252401 12252401 12715081 12715413 333
128077_125619_INS1121510 Chr11 12252401 12252401 12682497 12682165 333
128077_125827_INS1120750 Chr11 12252401 12252401 13688045 13688377 333
128077_127564_INS1121110 Chr11 12252401 12252401 12542506 12542174 333
128077_127652_INS1123580 Chr11 12252401 12252401 12514874 12514542 333
128077_127742_INS1122180 Chr11 12252401 12252401 13367349 13367681 333
128077_132424_INS1122210 Chr11 12252401 12252401 12599577 12599245 333
128077_CN1_INS1123350 Chr11 12252401 12252401 14184371 14184703 333
128077_DG_INS1122710 Chr11 12252401 12252401 14771557 14771889 333
128077_FH838_INS1123450 Chr11 12252401 12252401 14374408 14374740 333
128077_G46_INS1122510 Chr11 12252401 12252401 13222795 13223127 333
128077_G630_INS1122040 Chr11 12252401 12252401 13625735 13626067 333
128077_G8_INS1121960 Chr11 12252401 12252401 12706738 12707070 333
128077_HZ_INS1122000 Chr11 12252401 12252401 13135737 13135405 333
128077_II32_INS1121570 Chr11 12252401 12252401 14243828 14243496 333
128077_IR64_INS1121050 Chr11 12252401 12252401 12715272 12715604 333
128077_J4155_INS1119850 Chr11 12252401 12252401 12499255 12498923 333
128077_J4155S_INS1120610 Chr11 12252401 12252401 13149976 13149644 333
128077_LK638S_INS1121150 Chr11 12252401 12252401 13182026 13181694 333
128077_R498_INS1121870 Chr11 12252401 12252401 13118906 13119238 333
128077_R527_INS1122410 Chr11 12252401 12252401 13414146 13414478 333
128077_R9311_INS1123150 Chr11 12252401 12252401 13297371 13297703 333
128077_S548_INS1122950 Chr11 12252401 12252401 13320119 13320451 333
128077_TM_INS1122530 Chr11 12252401 12252401 14098499 14098831 333
128077_TM_INS1122530_1 Chr11 12252401 12322820 14098832 14195585 96754
128077_Tumba_INS1121840 Chr11 12252401 12252401 13151286 13151618 333
128077_WSSM_INS1120380 Chr11 12252401 12252401 12924095 12924427 333
128077_XL628S_INS1121110 Chr11 12252401 12252401 13176114 13175782 333
128077_Y3551_INS1121530 Chr11 12252401 12252401 12995459 12995127 333
128077_Y58S_INS1120360 Chr11 12252401 12252401 13881967 13881635 333
128077_YX1_INS1122320 Chr11 12252401 12252401 12888813 12889145 333
128077_ZS97RS3_INS1122300 Chr11 12252401 12252401 13282788 13282456 333
128077_MH63RS3_INS1122890 Chr11 12252401 12252401 13398919 13399251 333

>128077_127742_INS1122180
tttgtagggagtaccatcactattttctgatcttagcccattgtatgagcaacctggcaaggtaatagcagttatgcttctcaaaatcattttttgtacttctttttctctgttgtagcatgatctttcagattgccctacataatgtttattttttatacctatagccatattgattacttcagatttgacatggaaaaatgtgaaatatttaaaagaactcagattcagtcagaactattgtgtaagcatgcatagaaagctaccctaaatagacttgatgcccatttgtcaagtacagcctacatgtgaagtaatctaatacaagcagtt

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.