Variation ID: 128077_125619_INS0105600

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
535 bp
3948220
3948754
29
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
128077_125619_INS0105600 Chr01 3882002 3882002 3948220 3948754 535
128077_127518_INS0106470 Chr01 3882002 3882002 3962533 3963067 535
128077_127564_INS0105430 Chr01 3882002 3882002 3877806 3878340 535
128077_127742_INS0105440 Chr01 3882002 3882002 3964052 3964586 535
128077_132424_INS0105820 Chr01 3882002 3882002 3897289 3897823 535
128077_Basmati1_INS0105320 Chr01 3882002 3882002 3913736 3914270 535
128077_D62_INS0105940 Chr01 3882002 3882002 3736873 3737407 535
128077_DG_INS0106100 Chr01 3882002 3882002 3730108 3730642 535
128077_FH838_INS0105060 Chr01 3882002 3882002 4231288 4231822 535
128077_FS32_INS0104480 Chr01 3882002 3882002 3879806 3880340 535
128077_G630_INS0105090 Chr01 3882002 3882002 3942339 3942873 535
128077_G8_INS0105250 Chr01 3882002 3882002 3966034 3966568 535
128077_HZ_INS0105200 Chr01 3882002 3882002 3973037 3973571 535
128077_II32_INS0104290 Chr01 3882002 3882002 3865892 3866426 535
128077_IR64_INS0106020 Chr01 3882002 3882002 3845676 3846210 535
128077_J4155_INS0104500 Chr01 3882002 3882002 3958666 3959200 535
128077_J4155S_INS0104540 Chr01 3882002 3882002 3971710 3972244 535
128077_LK638S_INS0104720 Chr01 3882002 3882002 4078992 4079526 535
128077_R527_INS0105590 Chr01 3882002 3882002 3957957 3958491 535
128077_R9311_INS0105930 Chr01 3882002 3882002 3958207 3958741 535
128077_S548_INS0105210 Chr01 3882002 3882002 3965902 3966436 535
128077_Tumba_INS0105370 Chr01 3882002 3882002 3872026 3872560 535
128077_WSSM_INS0105100 Chr01 3882002 3882002 3962184 3962718 535
128077_XL628S_INS0105810 Chr01 3882002 3882002 3861680 3862214 535
128077_Y3551_INS0105120 Chr01 3882002 3882002 3942328 3942862 535
128077_Y58S_INS0104440 Chr01 3882002 3882002 3959032 3959566 535
128077_YX1_INS0104290 Chr01 3882002 3882002 3866459 3866993 535
128077_ZS97RS3_INS0104300 Chr01 3882002 3882002 3876430 3876964 535
128077_MH63RS3_INS0105060 Chr01 3882002 3882002 3948257 3948791 535

>128077_125619_INS0105600
ggcctgtttggttggcaacctgagtgatgtgcctaagaaaactacatgcctaagaggcattagctatcctgtcaaaacttgcctgatgaggctagcctgagcaaatgttgtttggttagtagcctaagcctgaggaaactaaattgagattagatggttcataattacatggttaaggtagatattatttaaataaaacggtatcttatatcctaatctatcgcatataagcaaatgttgtattttcggttcgtttgcaccaaccaagattcaacaataaaatattccaacaccttttgcatgcacagtcgtgggcccgtgacaggacaagcttgattagcgcgttttgttttgtgtaactagactgagccaggcgctcgtttttggtggcctgagctaggctaatgaacctatcaggtttttcaggtcaggcagagaatgaaaccatcaggctaccaaccaaacgacacaggatatccctcagggacatatcaggccaggctcttttggctcagggcttcaaccaaacagcccc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.