Variation ID: 127652_127742_INS0106880

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
535 bp
3964052
3964586
29
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
127652_125619_INS0106170 Chr01 3895841 3895841 3948220 3948754 535
127652_127518_INS0106350 Chr01 3895841 3895841 3962533 3963067 535
127652_127564_INS0105780 Chr01 3895841 3895841 3877806 3878340 535
127652_127742_INS0106880 Chr01 3895841 3895841 3964052 3964586 535
127652_132424_INS0105700 Chr01 3895841 3895841 3897289 3897823 535
127652_Basmati1_INS0106410 Chr01 3895841 3895841 3913736 3914270 535
127652_D62_INS0104980 Chr01 3895841 3895841 3736873 3737407 535
127652_DG_INS0104840 Chr01 3895841 3895841 3730108 3730642 535
127652_FH838_INS0107160 Chr01 3895841 3895841 4231288 4231822 535
127652_FS32_INS0105660 Chr01 3895841 3895841 3879806 3880340 535
127652_G630_INS0107020 Chr01 3895841 3895841 3942339 3942873 535
127652_G8_INS0106920 Chr01 3895841 3895841 3966034 3966568 535
127652_HZ_INS0106810 Chr01 3895841 3895841 3973037 3973571 535
127652_II32_INS0105860 Chr01 3895841 3895841 3865892 3866426 535
127652_IR64_INS0106170 Chr01 3895841 3895841 3845676 3846210 535
127652_J4155_INS0106750 Chr01 3895841 3895841 3958666 3959200 535
127652_J4155S_INS0106850 Chr01 3895841 3895841 3971710 3972244 535
127652_LK638S_INS0106490 Chr01 3895841 3895841 4078992 4079526 535
127652_R527_INS0107000 Chr01 3895841 3895841 3957957 3958491 535
127652_R9311_INS0106850 Chr01 3895841 3895841 3958207 3958741 535
127652_S548_INS0107010 Chr01 3895841 3895841 3965902 3966436 535
127652_Tumba_INS0106380 Chr01 3895841 3895841 3872026 3872560 535
127652_WSSM_INS0106710 Chr01 3895841 3895841 3962184 3962718 535
127652_XL628S_INS0105750 Chr01 3895841 3895841 3861680 3862214 535
127652_Y3551_INS0106910 Chr01 3895841 3895841 3942328 3942862 535
127652_Y58S_INS0107000 Chr01 3895841 3895841 3959032 3959566 535
127652_YX1_INS0105760 Chr01 3895841 3895841 3866459 3866993 535
127652_ZS97RS3_INS0105890 Chr01 3895841 3895841 3876430 3876964 535
127652_MH63RS3_INS0107090 Chr01 3895841 3895841 3948257 3948791 535

>127652_127742_INS0106880
ggcctgtttggttggcaacctgagtgatgtgcctaagaaaactacatgcctaagaggcattagctatcctgtcaaaacttgcctgatgaggctagcctgagcaaatgttgtttggttagtagcctaagcctgaggaaactaaattgagattagatggttcataattacatggttaaggtagatattatttaaataaaacggtatcttatatcctaatctatcgcatataagcaaatgttgtattttcggttcgtttgcaccaaccaagattcaacaataaaatattccaacaccttttgcatgcacagtcgtgggcccgtgacaggacaagcttgattagcgcgttttgttttgtgtaactagactgagccaggcgctcgtttttggtggcctgagctaggctaatgaacctatcaggtttttcaggtcaggcagagaatgaaaccatcaggctaccaaccaaacgacacaggatatccctcagggacatatcaggccaggctcttttggctcagggcttcaaccaaacagcccc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.