Variation ID: 125827_127742_DEL0436390

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
284 bp
28910757
28911040
7
Gene_id Chromosome Start End
OsPr106_04g0022670 Chr04 28906579 28916265
SV_id Chromosome ref_start ref_end query_start query_end length
125827_127742_DEL0436390 Chr04 33752960 33753241 28910757 28911040 284
125827_D62_DEL0433530 Chr04 33752960 33753241 28340582 28340865 284
125827_G8_DEL0435080 Chr04 33752960 33753241 28619971 28620254 284
125827_HZ_DEL0436510 Chr04 33752960 33753241 29082424 29082707 284
125827_R498_DEL0437400 Chr04 33752960 33753241 27802941 27803224 284
125827_R527_DEL0437810 Chr04 33752960 33753241 28383602 28383885 284
125827_S548_DEL0437910 Chr04 33752960 33753241 27864659 27864942 284

>125827_127742_DEL0436390
tgtagcgcccgttccgtcgtggcgcctagcgggaaaattatctcttaaaaaccctaattgcgaaatttgtttctttgcttgttgtctagtgtccgtgccatctcaagatctcaaatccccgatatatcgtcgagttcaattccgaatctaaatccttccaaatcaaatccctccgcaaaagtctattttgcctcccccggggtcgatgggccgaatctctttcggcccatctccccctccctctcggcgctctctctctctctctctctctctctccctctctc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.