Rice Gene Index: a comprehensive database for homology, collinearity, and transcripts of genes in rice pangenome.

Variation ID: 125619_132424_OTH1114970

Variant Type:

Ref Genome:

Query Genome:

Chromosome:

Ref Start:

Ref End:

OTH

Os XI-2B: LARHA MUGAD | Os125619RS1

Os XI-2A: GOBOL SAIL | Os132424RS1

Chr11

12884055

12884200

SV Length:

Query Start:

Query End:

Allele sv Count:

90 bp

12789904

12789815

25 There is no gene in this region.

SV_id	Chromosome	ref_start	ref_end	query_start	query_end	length
125619_117425_OTH1122830	Chr11	12884055	12884200	11898562	11898473	90
125619_125827_OTH1113220	Chr11	12884055	12884200	13485665	13485576	90
125619_127564_OTH1115260	Chr11	12884055	12884200	12732868	12732779	90
125619_127652_OTH1121760	Chr11	12884055	12884200	12729939	12729850	90
125619_132424_OTH1114970	Chr11	12884055	12884200	12789904	12789815	90
125619_Azucena_OTH1125460	Chr11	12884055	12884200	12402401	12402312	90
125619_Basmati1_OTH1123710	Chr11	12884055	12884200	12652651	12652562	90
125619_CN1_OTH1111010	Chr11	12884055	12884200	13981935	13981846	90
125619_DG_OTH1109310	Chr11	12884055	12884200	14569134	14569045	90
125619_FH838_OTH1111570	Chr11	12884055	12884200	14173720	14173631	90
125619_G46_OTH1111430	Chr11	12884055	12884200	12900103	12900192	90
125619_G8_OTH1109180	Chr11	12884055	12884200	12504326	12504237	90
125619_HZ_OTH1111460	Chr11	12884055	12884200	13338129	13338218	90
125619_II32_OTH1109010	Chr11	12884055	12884200	14446249	14446338	90
125619_IR64_OTH1111190	Chr11	12884055	12884200	12512837	12512748	90
125619_J4155_OTH1111320	Chr11	12884055	12884200	12701642	12701731	90
125619_J4155S_OTH1113270	Chr11	12884055	12884200	13352419	13352508	90
125619_LJ_OTH1122680	Chr11	12884055	12884200	12092542	12092630	89
125619_LK638S_OTH1113290	Chr11	12884055	12884200	13384466	13384555	90
125619_TM_OTH1112370	Chr11	12884055	12884200	13896065	13895976	90
125619_WSSM_OTH1113820	Chr11	12884055	12884200	12721743	12721654	90
125619_XL628S_OTH1112170	Chr11	12884055	12884200	13378541	13378630	90
125619_Y3551_OTH1116970	Chr11	12884055	12884200	13211642	13211553	90
125619_Y58S_OTH1122980	Chr11	12884055	12884200	14098161	14098072	90
125619_ZS97RS3_OTH1110730	Chr11	12884055	12884200	13485231	13485320	90

>125619_132424_OTH1114970
cacccacttggtaaaataatcggttgccaccaatataaacttatgtcctttactcgatggtggattaatcatgccgatcatatcaattcc