Variation ID: 02428_127652_INS1123210

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
333 bp
12514874
12514542
30
Gene_id Chromosome Start End
OsNaBo_11g0011480 Chr11 12510597 12516881
SV_id Chromosome ref_start ref_end query_start query_end length
02428_117534_INS1119410 Chr11 12173140 12173140 12715081 12715413 333
02428_125619_INS1118370 Chr11 12173140 12173140 12682497 12682165 333
02428_125827_INS1118660 Chr11 12173140 12173140 13688045 13688377 333
02428_127564_INS1119220 Chr11 12173140 12173140 12542506 12542174 333
02428_127652_INS1123210 Chr11 12173140 12173140 12514874 12514542 333
02428_127742_INS1121170 Chr11 12173140 12173140 13367349 13367681 333
02428_132424_INS1119320 Chr11 12173140 12173140 12599577 12599245 333
02428_CN1_INS1118480 Chr11 12173140 12173140 14184371 14184703 333
02428_DG_INS1118420 Chr11 12173140 12173140 14771557 14771889 333
02428_FH838_INS1119250 Chr11 12173140 12173140 14374408 14374740 333
02428_G46_INS1119290 Chr11 12173140 12173140 13222795 13223127 333
02428_G630_INS1121780 Chr11 12173140 12173140 13625735 13626067 333
02428_G8_INS1118090 Chr11 12173140 12173140 12706738 12707070 333
02428_HZ_INS1119430 Chr11 12173140 12173140 13135737 13135405 333
02428_IR64_INS1118390 Chr11 12173140 12173140 12715272 12715604 333
02428_J4155_INS1115840 Chr11 12173140 12173140 12499255 12498923 333
02428_J4155S_INS1119990 Chr11 12173140 12173140 13149976 13149644 333
02428_LK638S_INS1119810 Chr11 12173140 12173140 13182026 13181694 333
02428_R498_INS1118690 Chr11 12173140 12173140 13118906 13119238 333
02428_R527_INS1120250 Chr11 12173140 12173140 13414146 13414478 333
02428_R9311_INS1120870 Chr11 12173140 12173140 13297371 13297703 333
02428_S548_INS1119580 Chr11 12173140 12173140 13320119 13320451 333
02428_Tumba_INS1117190 Chr11 12173140 12173140 13151286 13151618 333
02428_WSSM_INS1118260 Chr11 12173140 12173140 12924095 12924427 333
02428_XL628S_INS1118510 Chr11 12173140 12173140 13176114 13175782 333
02428_Y3551_INS1117490 Chr11 12173140 12173140 12995459 12995127 333
02428_Y58S_INS1120300 Chr11 12173140 12173140 13881967 13881635 333
02428_YX1_INS1118510 Chr11 12173140 12173140 12888813 12889145 333
02428_ZS97RS3_INS1117900 Chr11 12173140 12173140 13282788 13282456 333
02428_MH63RS3_INS1122230 Chr11 12173140 12173140 13398919 13399251 333

>02428_127652_INS1123210
aactgcttgtattagattacttcacatgtaggctgtacttgacaaatgggcatcaagtctatttagggtagctttctatgcatgcttacacaatagttctgactgaatctgagttcttttaaatatttcacatttttccatgtcaaatctgaagtaatcaatatggctataggtataaaaaataaacattatgtagggcaatctgaaagatcatgctacaacagagaaaaagaagtacaaaaaatgattttgagaagcataactgctattaccttgccaggttgctcatacaatgggctaagatcagaaaatagtgatggtactccctacaaa

Powered by

© 2021-2025 Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.