Variation ID: 02428_125619_INS0108950

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
535 bp
3948220
3948754
29
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
02428_125619_INS0108950 Chr01 4289314 4289314 3948220 3948754 535
02428_127518_INS0107960 Chr01 4289314 4289314 3962533 3963067 535
02428_127564_INS0108980 Chr01 4289314 4289314 3877806 3878340 535
02428_127742_INS0108610 Chr01 4289314 4289314 3964052 3964586 535
02428_132424_INS0107880 Chr01 4289314 4289314 3897289 3897823 535
02428_Basmati1_INS0106500 Chr01 4289314 4289314 3913736 3914270 535
02428_D62_INS0108370 Chr01 4289314 4289314 3736873 3737407 535
02428_DG_INS0108640 Chr01 4289314 4289314 3730108 3730642 535
02428_FH838_INS0108310 Chr01 4289314 4289314 4231288 4231822 535
02428_FS32_INS0108100 Chr01 4289314 4289314 3879806 3880340 535
02428_G630_INS0108360 Chr01 4289314 4289314 3942339 3942873 535
02428_G8_INS0108450 Chr01 4289314 4289314 3966034 3966568 535
02428_HZ_INS0108520 Chr01 4289314 4289314 3973037 3973571 535
02428_II32_INS0108240 Chr01 4289314 4289314 3865892 3866426 535
02428_IR64_INS0108870 Chr01 4289314 4289314 3845676 3846210 535
02428_J4155_INS0106910 Chr01 4289314 4289314 3958666 3959200 535
02428_J4155S_INS0106890 Chr01 4289314 4289314 3971710 3972244 535
02428_LK638S_INS0106470 Chr01 4289314 4289314 4078992 4079526 535
02428_R527_INS0108670 Chr01 4289314 4289314 3957957 3958491 535
02428_R9311_INS0108760 Chr01 4289314 4289314 3958207 3958741 535
02428_S548_INS0108360 Chr01 4289314 4289314 3965902 3966436 535
02428_Tumba_INS0108680 Chr01 4289314 4289314 3872026 3872560 535
02428_WSSM_INS0108600 Chr01 4289314 4289314 3962184 3962718 535
02428_XL628S_INS0109190 Chr01 4289314 4289314 3861680 3862214 535
02428_Y3551_INS0108280 Chr01 4289314 4289314 3942328 3942862 535
02428_Y58S_INS0106310 Chr01 4289314 4289314 3959032 3959566 535
02428_YX1_INS0108350 Chr01 4289314 4289314 3866459 3866993 535
02428_ZS97RS3_INS0108340 Chr01 4289314 4289314 3876430 3876964 535
02428_MH63RS3_INS0108300 Chr01 4289314 4289314 3948257 3948791 535

>02428_125619_INS0108950
ggcctgtttggttggcaacctgagtgatgtgcctaagaaaactacatgcctaagaggcattagctatcctgtcaaaacttgcctgatgaggctagcctgagcaaatgttgtttggttagtagcctaagcctgaggaaactaaattgagattagatggttcataattacatggttaaggtagatattatttaaataaaacggtatcttatatcctaatctatcgcatataagcaaatgttgtattttcggttcgtttgcaccaaccaagattcaacaataaaatattccaacaccttttgcatgcacagtcgtgggcccgtgacaggacaagcttgattagcgcgttttgttttgtgtaactagactgagccaggcgctcgtttttggtggcctgagctaggctaatgaacctatcaggtttttcaggtcaggcagagaatgaaaccatcaggctaccaaccaaacgacacaggatatccctcagggacatatcaggccaggctcttttggctcagggcttcaaccaaacagcccc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.