Variation ID: ZH11_125827_INS1119890

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
333 bp
13688045
13688377
30
Gene_id Chromosome Start End
OsLiXu_11g0011350 Chr11 13686075 13692462
SV_id Chromosome ref_start ref_end query_start query_end length
ZH11_117534_INS1117770 Chr11 12110085 12110085 12715081 12715413 333
ZH11_125619_INS1120120 Chr11 12110085 12110085 12682497 12682165 333
ZH11_125827_INS1119890 Chr11 12110085 12110085 13688045 13688377 333
ZH11_127564_INS1120520 Chr11 12110085 12110085 12542506 12542174 333
ZH11_127652_INS1122440 Chr11 12110085 12110085 12514874 12514542 333
ZH11_127742_INS1121470 Chr11 12110085 12110085 13367349 13367681 333
ZH11_132424_INS1120210 Chr11 12110085 12110085 12599577 12599245 333
ZH11_CN1_INS1121800 Chr11 12110085 12110085 14184371 14184703 333
ZH11_DG_INS1121300 Chr11 12110085 12110085 14771557 14771889 333
ZH11_FH838_INS1123410 Chr11 12110085 12110085 14374408 14374740 333
ZH11_G46_INS1121730 Chr11 12110085 12110085 13222795 13223127 333
ZH11_G630_INS1121220 Chr11 12110085 12110085 13625735 13626067 333
ZH11_G8_INS1121150 Chr11 12110085 12110085 12706738 12707070 333
ZH11_HZ_INS1122160 Chr11 12110085 12110085 13135737 13135405 333
ZH11_IR64_INS1120350 Chr11 12110085 12110085 12715272 12715604 333
ZH11_J4155_INS1119280 Chr11 12110085 12110085 12499255 12498923 333
ZH11_J4155S_INS1121570 Chr11 12110085 12110085 13149976 13149644 333
ZH11_LK638S_INS1121600 Chr11 12110085 12110085 13182026 13181694 333
ZH11_R498_INS1121740 Chr11 12110085 12110085 13118906 13119238 333
ZH11_R527_INS1120720 Chr11 12110085 12110085 13414146 13414478 333
ZH11_R9311_INS1122140 Chr11 12110085 12110085 13297371 13297703 333
ZH11_S548_INS1121160 Chr11 12110085 12110085 13320119 13320451 333
ZH11_Tumba_INS1119900 Chr11 12110085 12110085 13151286 13151618 333
ZH11_WSSM_INS1120510 Chr11 12110085 12110085 12924095 12924427 333
ZH11_XL628S_INS1121250 Chr11 12110085 12110085 13176114 13175782 333
ZH11_Y3551_INS1120210 Chr11 12110085 12110085 12995459 12995127 333
ZH11_Y58S_INS1117270 Chr11 12110085 12110085 13881967 13881635 333
ZH11_YX1_INS1121000 Chr11 12110085 12110085 12888813 12889145 333
ZH11_ZS97RS3_INS1121470 Chr11 12110085 12110085 13282788 13282456 333
ZH11_MH63RS3_INS1121920 Chr11 12110085 12110085 13398919 13399251 333

>ZH11_125827_INS1119890
tttgtagggagtaccatcactattttctgatcttagcccattgtatgagcaacctggcaaggtaatagcagttatgcttctcaaaatcattttttgtacttctttttctctgttgtagcatgatctttcagattgccctacataatgtttattttttatacctatagccatattgattacttcagatttgacatggaaaaatgtgaaatatttaaaagaactcagattcagtcagaactattgtgtaagcatgcatagaaagctaccctaaatagacttgatgcccatttgtcaagtacagcctacatgtgaagtaatctaatacaagcagtt

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.