Variation ID: S548_IR64_OTH1213920

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
24939209
24939513
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
S548_125619_OTH1246310 Chr12 25641569 25642143 26778614 26778918 305
S548_125827_OTH1233490 Chr12 25641569 25642143 26227141 26227445 305
S548_127564_OTH1228520 Chr12 25641569 25642143 25892080 25892384 305
S548_D62_OTH1224750 Chr12 25641569 25642143 25841227 25841531 305
S548_G8_OTH1222880 Chr12 25641569 25642143 26058615 26058919 305
S548_IR64_OTH1213920 Chr12 25641569 25642143 24939209 24939513 305
S548_R527_OTH1208060 Chr12 25641569 25642143 25264218 25264522 305
S548_R9311_OTH1230650 Chr12 25641569 25642143 25476923 25477227 305
S548_TM_OTH1229360 Chr12 25641569 25642143 25684785 25685089 305
S548_WSSM_OTH1220880 Chr12 25641569 25642143 25542750 25543054 305
S548_Y58S_OTH1228190 Chr12 25641569 25642143 26942379 26942683 305

>S548_IR64_OTH1213920
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.