Variation ID: R498_IR64_OTH1240220

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
24939209
24939513
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
R498_125619_OTH1243530 Chr12 26049524 26050098 26778614 26778918 305
R498_125827_OTH1246070 Chr12 26049524 26050098 26227141 26227445 305
R498_127564_OTH1243030 Chr12 26049524 26050098 25892080 25892384 305
R498_D62_OTH1235790 Chr12 26049524 26050098 25841227 25841531 305
R498_G8_OTH1240070 Chr12 26049524 26050098 26058615 26058919 305
R498_IR64_OTH1240220 Chr12 26049524 26050098 24939209 24939513 305
R498_R527_OTH1237110 Chr12 26049524 26050098 25264218 25264522 305
R498_R9311_OTH1229610 Chr12 26049524 26050098 25476923 25477227 305
R498_TM_OTH1240640 Chr12 26049524 26050098 25684785 25685089 305
R498_WSSM_OTH1235160 Chr12 26049524 26050098 25542750 25543054 305
R498_Y58S_OTH1242530 Chr12 26049524 26050098 26942379 26942683 305

>R498_IR64_OTH1240220
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.