Variation ID: LK638S_125619_OTH1244100

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
26778614
26778918
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
LK638S_125619_OTH1244100 Chr12 26728640 26729214 26778614 26778918 305
LK638S_125827_OTH1245030 Chr12 26728640 26729214 26227141 26227445 305
LK638S_127564_OTH1238800 Chr12 26728640 26729214 25892080 25892384 305
LK638S_D62_OTH1237030 Chr12 26728640 26729214 25841227 25841531 305
LK638S_G8_OTH1235410 Chr12 26728640 26729214 26058615 26058919 305
LK638S_IR64_OTH1235870 Chr12 26728640 26729214 24939209 24939513 305
LK638S_R527_OTH1237870 Chr12 26728640 26729214 25264218 25264522 305
LK638S_R9311_OTH1239400 Chr12 26728640 26729214 25476923 25477227 305
LK638S_TM_OTH1237860 Chr12 26728640 26729214 25684785 25685089 305
LK638S_WSSM_OTH1236740 Chr12 26728640 26729214 25542750 25543054 305
LK638S_Y58S_OTH1240260 Chr12 26728640 26729214 26942379 26942683 305

>LK638S_125619_OTH1244100
tacgacgtacacatcgatctatacctctaacaagtccaaacatctactgtcacgctgtactctaccaacccaaacatgttccgacactacgtccgaagtaccgaaacacgaccgaccgcccttctgtacgacgtacacatcgatatgtacctctaacaagtccaaagacatgatacatgctagttctatcggcatgctgtactctaccaacccaaacttgttcggacactacgtccaaagtaccgaaacacgaccgatcgccctgctatacgacatacacatcgatgtatacctctaacaagtcc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.