Variation ID: LJ_128077_INS1210130

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
141 bp
9160299
9160439
12
Gene_id Chromosome Start End
OsKeNa_12g0009080 Chr12 9158097 9166208
SV_id Chromosome ref_start ref_end query_start query_end length
LJ_02428_INS1207030 Chr12 9507476 9507616 9238961 9239101 141
LJ_128077_INS1210130 Chr12 9507476 9507616 9160299 9160439 141
LJ_DHX2_INS1207950 Chr12 9507476 9507616 9225885 9226025 141
LJ_FH838_INS1218700 Chr12 9507476 9507616 8923541 8923681 141
LJ_G630_INS1219040 Chr12 9507476 9507616 9047152 9047292 141
LJ_Kosh_INS1208060 Chr12 9507476 9507616 9196339 9196479 141
LJ_KY131_INS1207150 Chr12 9507476 9507616 9086986 9087126 141
LJ_Lemont_INS1206320 Chr12 9507476 9507616 9277018 9277158 141
LJ_Nipponbare_INS1209300 Chr12 9507476 9507616 9806561 9806701 141
LJ_Y3551_INS1218530 Chr12 9507476 9507616 8811407 8811547 141
LJ_ZH11_INS1207420 Chr12 9507476 9507616 9157906 9158046 141
LJ_MH63RS3_INS1218840 Chr12 9507476 9507616 8815441 8815581 141

>LJ_128077_INS1210130
tgtagctagaatattacaattaagagtgcaaagtgttttattgggtttgttctagttctagatacaaccatatctgtctgtacgtttcggatttgctatatatcttgcgacagaaaattgaagttggaaacttccaaattt

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.