Variation ID: LJ_127742_INS0401550

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
308 bp
28910757
28911064
7
Gene_id Chromosome Start End
OsPr106_04g0022670 Chr04 28906579 28916265
SV_id Chromosome ref_start ref_end query_start query_end length
LJ_127742_INS0401550 Chr04 869987 870295 28910757 28911064 308
LJ_HZ_INS0401630 Chr04 869987 870295 29082424 29082731 308
LJ_R498_INS0401600 Chr04 869987 870295 27802941 27803248 308
LJ_R527_INS0401580 Chr04 869987 870295 28383602 28383909 308
LJ_S548_INS0401580 Chr04 869987 870295 27864659 27864966 308
LJ_XL628S_INS0401530 Chr04 869987 870295 28964745 28965050 306
LJ_YX1_INS0401540 Chr04 869987 870295 27366337 27366644 308

>LJ_127742_INS0401550
tgtagcgcccgttccgtcgtggcgcctagcgggaaaattatctcttaaaaaccctaattgcgaaatttgtttctttgcttgttgtctagtgtccgtgccatctcaagatctcaaatccccgatatatcgtcgagttcaattccgaatctaaatccttccaaatcaaatccctccgcaaaagtctattttgcctcccccggggtcgatgggccgaatctctttcggcccatctccccctccctctcggcgctctctctctctctctctctctctctccctctctcccttcccctcgctctgcccgcgcg

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.