Variation ID: J4155_MH63RS3_INS0318850

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
101 bp
26567435
26567535
5
Gene_id Chromosome Start End
OsMH63_03G0416800 Chr03 26567117 26572659
SV_id Chromosome ref_start ref_end query_start query_end length
J4155_R498_INS0316380 Chr03 25700390 25700390 26327300 26327398 99
J4155_R527_INS0316630 Chr03 25700390 25700390 26620653 26620753 101
J4155_WSSM_INS0315630 Chr03 25700390 25700390 26569421 26569539 119
J4155_YX1_INS0307620 Chr03 25700390 25700390 25835854 25835978 125
J4155_MH63RS3_INS0318850 Chr03 25700390 25700390 26567435 26567535 101

>J4155_MH63RS3_INS0318850
ACATATATATATATATATACATATATACATATATATATATATATACATATATACATATATATATATATATATACATATATATACATATACATATATATATG

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.