Variation ID: J4155_IR64_OTH1225780

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
24939209
24939513
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
J4155_125619_OTH1250380 Chr12 26481482 26482056 26778614 26778918 305
J4155_125827_OTH1231340 Chr12 26481482 26482056 26227141 26227445 305
J4155_127564_OTH1228230 Chr12 26481482 26482056 25892080 25892384 305
J4155_D62_OTH1234020 Chr12 26481482 26482056 25841227 25841531 305
J4155_G8_OTH1236400 Chr12 26481482 26482056 26058615 26058919 305
J4155_IR64_OTH1225780 Chr12 26481482 26482056 24939209 24939513 305
J4155_R527_OTH1230650 Chr12 26481482 26482056 25264218 25264522 305
J4155_R9311_OTH1241190 Chr12 26481482 26482056 25476923 25477227 305
J4155_TM_OTH1228400 Chr12 26481482 26482056 25684785 25685089 305
J4155_WSSM_OTH1229000 Chr12 26481482 26482056 25542750 25543054 305
J4155_Y58S_OTH1208150 Chr12 26481482 26482056 26942379 26942683 305

>J4155_IR64_OTH1225780
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.