Variation ID: HZ_Tumba_OTH1208210

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
65 bp
9345597
9345661
15
Gene_id Chromosome Start End
OsTumbaG1226926000.01 Chr12 9339950 9381838
SV_id Chromosome ref_start ref_end query_start query_end length
HZ_02428_OTH1217190 Chr12 9049663 9052977 9220893 9220949 57
HZ_125827_OTH1208260 Chr12 9049663 9053173 9097476 9097640 165
HZ_132278_OTH1217230 Chr12 9049663 9052977 9709423 9709487 65
HZ_Azucena_OTH1217560 Chr12 9049663 9052975 9549382 9549448 67
HZ_DHX2_OTH1217150 Chr12 9049663 9052977 9207817 9207873 57
HZ_FH838_OTH1208670 Chr12 9049663 9052977 8905473 8905529 57
HZ_G630_OTH1207210 Chr12 9049663 9052977 9029084 9029140 57
HZ_Kosh_OTH1217260 Chr12 9049663 9052977 9178271 9178327 57
HZ_KY131_OTH1217250 Chr12 9049663 9052977 9068918 9068974 57
HZ_Lemont_OTH1217310 Chr12 9049663 9052977 9258951 9259007 57
HZ_NamRoo_OTH1216120 Chr12 9049663 9052977 9301946 9302010 65
HZ_Nipponbare_OTH1217480 Chr12 9049663 9052977 9788493 9788549 57
HZ_Tumba_OTH1208210 Chr12 9049663 9052977 9345597 9345661 65
HZ_ZH11_OTH1217460 Chr12 9049663 9052977 9139838 9139894 57
HZ_OglaRS2_OTH1220820 Chr12 9049663 9052977 8551617 8551673 57

>HZ_Tumba_OTH1208210
TATGTATTGCAATTGGAATATATTGAGTGTACACTGTTTTTATGCAATCTATCTATTATATTATT

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.