Variation ID: HZ_125619_OTH1244530

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
26778614
26778918
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
HZ_125619_OTH1244530 Chr12 25508176 25508750 26778614 26778918 305
HZ_125827_OTH1234840 Chr12 25508176 25508750 26227141 26227445 305
HZ_127564_OTH1227260 Chr12 25508176 25508750 25892080 25892384 305
HZ_D62_OTH1223140 Chr12 25508176 25508750 25841227 25841531 305
HZ_G8_OTH1223020 Chr12 25508176 25508750 26058615 26058919 305
HZ_IR64_OTH1216100 Chr12 25508176 25508750 24939209 24939513 305
HZ_R527_OTH1210100 Chr12 25508176 25508750 25264218 25264522 305
HZ_R9311_OTH1226090 Chr12 25508176 25508750 25476923 25477227 305
HZ_TM_OTH1226600 Chr12 25508176 25508750 25684785 25685089 305
HZ_WSSM_OTH1214490 Chr12 25508176 25508750 25542750 25543054 305
HZ_Y58S_OTH1229930 Chr12 25508176 25508750 26942379 26942683 305

>HZ_125619_OTH1244530
tacgacgtacacatcgatctatacctctaacaagtccaaacatctactgtcacgctgtactctaccaacccaaacatgttccgacactacgtccgaagtaccgaaacacgaccgaccgcccttctgtacgacgtacacatcgatatgtacctctaacaagtccaaagacatgatacatgctagttctatcggcatgctgtactctaccaacccaaacttgttcggacactacgtccaaagtaccgaaacacgaccgatcgccctgctatacgacatacacatcgatgtatacctctaacaagtcc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.