Variation ID: G630_125827_OTH1240470

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
26227141
26227445
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
G630_125619_OTH1246070 Chr12 25920066 25920640 26778614 26778918 305
G630_125827_OTH1240470 Chr12 25920066 25920640 26227141 26227445 305
G630_127564_OTH1235900 Chr12 25920066 25920640 25892080 25892384 305
G630_D62_OTH1229560 Chr12 25920066 25920640 25841227 25841531 305
G630_G8_OTH1241660 Chr12 25920066 25920640 26058615 26058919 305
G630_IR64_OTH1237410 Chr12 25920066 25920640 24939209 24939513 305
G630_R527_OTH1231720 Chr12 25920066 25920640 25264218 25264522 305
G630_R9311_OTH1240330 Chr12 25920066 25920640 25476923 25477227 305
G630_TM_OTH1235160 Chr12 25920066 25920640 25684785 25685089 305
G630_WSSM_OTH1232630 Chr12 25920066 25920640 25542750 25543054 305
G630_Y58S_OTH1234320 Chr12 25920066 25920640 26942379 26942683 305

>G630_125827_OTH1240470
tacgacgtacacatcgatctatacctctaacaagtccaaacatctactgtcacgctgtactctaccaacccaaacatgttccgacactacgtccgaagtaccgaaacacgaccgaccgcccttctgtacgacgtacacatcgatatgtacctctaacaagtccaaagacatgatacatgctagttctatcggcatgctgtactctaccaacccaaacttgttcggacactacgtccaaagtaccgaaacacgaccgatcgccctgctatacgacatacacatcgatgtatacctctaacaagtcc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.