Variation ID: FS32_125619_OTH1238810

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
26778614
26778918
10
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
FS32_125619_OTH1238810 Chr12 26324953 26325527 26778614 26778918 305
FS32_125827_OTH1238140 Chr12 26324953 26325527 26227141 26227445 305
FS32_127564_OTH1228430 Chr12 26324953 26325527 25892080 25892384 305
FS32_D62_OTH1216990 Chr12 26324953 26325527 25841227 25841531 305
FS32_G8_OTH1233200 Chr12 26324953 26325527 26058615 26058919 305
FS32_IR64_OTH1231380 Chr12 26324953 26325527 24939209 24939513 305
FS32_R9311_OTH1233380 Chr12 26324953 26325527 25476923 25477227 305
FS32_TM_OTH1224900 Chr12 26324953 26325527 25684785 25685089 305
FS32_WSSM_OTH1228600 Chr12 26324953 26325527 25542750 25543054 305
FS32_Y58S_OTH1232440 Chr12 26324953 26325527 26942379 26942683 305

>FS32_125619_OTH1238810
tacgacgtacacatcgatctatacctctaacaagtccaaacatctactgtcacgctgtactctaccaacccaaacatgttccgacactacgtccgaagtaccgaaacacgaccgaccgcccttctgtacgacgtacacatcgatatgtacctctaacaagtccaaagacatgatacatgctagttctatcggcatgctgtactctaccaacccaaacttgttcggacactacgtccaaagtaccgaaacacgaccgatcgccctgctatacgacatacacatcgatgtatacctctaacaagtcc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.