Variation ID: FH838_IR64_OTH1238920

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
24939209
24939513
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
FH838_125619_OTH1245430 Chr12 25758510 25759084 26778614 26778918 305
FH838_125827_OTH1240470 Chr12 25758510 25759084 26227141 26227445 305
FH838_127564_OTH1237590 Chr12 25758510 25759084 25892080 25892384 305
FH838_D62_OTH1231910 Chr12 25758510 25759084 25841227 25841531 305
FH838_G8_OTH1239400 Chr12 25758510 25759084 26058615 26058919 305
FH838_IR64_OTH1238920 Chr12 25758510 25759084 24939209 24939513 305
FH838_R527_OTH1233170 Chr12 25758510 25759084 25264218 25264522 305
FH838_R9311_OTH1241280 Chr12 25758510 25759084 25476923 25477227 305
FH838_TM_OTH1237460 Chr12 25758510 25759084 25684785 25685089 305
FH838_WSSM_OTH1231420 Chr12 25758510 25759084 25542750 25543054 305
FH838_Y58S_OTH1236400 Chr12 25758510 25759084 26942379 26942683 305

>FH838_IR64_OTH1238920
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.