Variation ID: DHX2_132424_OTH0156450

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
290 bp
37981577
37981866
20
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
DHX2_125827_OTH0155600 Chr01 37124889 37124960 38390549 38390838 290
DHX2_127518_OTH0158570 Chr01 37124889 37124960 38360489 38360778 290
DHX2_127564_OTH0157500 Chr01 37124889 37124960 38305725 38306014 290
DHX2_127742_OTH0156960 Chr01 37124889 37124960 37860971 37861260 290
DHX2_132424_OTH0156450 Chr01 37124889 37124960 37981577 37981866 290
DHX2_D62_OTH0149220 Chr01 37124889 37124960 37793267 37793556 290
DHX2_FH838_OTH0156700 Chr01 37124889 37124960 38351206 38351495 290
DHX2_G630_OTH0156950 Chr01 37124889 37124960 38273962 38274251 290
DHX2_HZ_OTH0159060 Chr01 37124889 37124960 38339563 38339852 290
DHX2_IR64_OTH0160230 Chr01 37124889 37124960 37907582 37907871 290
DHX2_J4155_OTH0152860 Chr01 37124889 37124960 38145181 38145470 290
DHX2_J4155S_OTH0154260 Chr01 37124889 37124960 38621762 38622051 290
DHX2_Lemont_OTH0125670 Chr01 37124889 37124960 37755439 37755728 290
DHX2_R498_OTH0154510 Chr01 37124889 37124960 37725980 37726269 290
DHX2_R527_OTH0156550 Chr01 37124889 37124960 37929059 37929348 290
DHX2_S548_OTH0157310 Chr01 37124889 37124960 37609488 37609777 290
DHX2_WSSM_OTH0159140 Chr01 37124889 37124960 37858337 37858626 290
DHX2_Y3551_OTH0155910 Chr01 37124889 37124960 37968429 37968718 290
DHX2_Y58S_OTH0138980 Chr01 37124889 37124960 37082250 37082539 290
DHX2_MH63RS3_OTH0158200 Chr01 37124889 37124960 38545459 38545748 290

>DHX2_132424_OTH0156450
aagaagatgagataagagatgagccacacgccaatatctagttggatatgcaggagttcggctgagagcgttcccagcgcgcacagtaaacacggaaaacggagcggtcattagcgcgtgattaattaagtattagctaattttttttaaaaaaatggattaatttgattttttttaaacaacttttgtatagaaactttttgcaaaaaaatgcaccgtgtagtagtttgaaaagcgtgcgcggacgaaaagttactgtgcacgccgggaaaacagctgccgaacacagc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.