Variation ID: CN1_IR64_OTH1229790

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
24939209
24939513
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
CN1_125619_OTH1246130 Chr12 26777465 26778039 26778614 26778918 305
CN1_125827_OTH1227090 Chr12 26777465 26778039 26227141 26227445 305
CN1_127564_OTH1227580 Chr12 26777465 26778039 25892080 25892384 305
CN1_D62_OTH1232280 Chr12 26777465 26778039 25841227 25841531 305
CN1_G8_OTH1229260 Chr12 26777465 26778039 26058615 26058919 305
CN1_IR64_OTH1229790 Chr12 26777465 26778039 24939209 24939513 305
CN1_R527_OTH1225590 Chr12 26777465 26778039 25264218 25264522 305
CN1_R9311_OTH1241500 Chr12 26777465 26778039 25476923 25477227 305
CN1_TM_OTH1230690 Chr12 26777465 26778039 25684785 25685089 305
CN1_WSSM_OTH1224290 Chr12 26777465 26778039 25542750 25543054 305
CN1_Y58S_OTH1230230 Chr12 26777465 26778039 26942379 26942683 305

>CN1_IR64_OTH1229790
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.