Variation ID: 132424_R9311_OTH1235510

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
25476923
25477227
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
132424_125619_OTH1244240 Chr12 26022922 26023496 26778614 26778918 305
132424_125827_OTH1227340 Chr12 26022922 26023496 26227141 26227445 305
132424_127564_OTH1214930 Chr12 26022922 26023496 25892080 25892384 305
132424_D62_OTH1227880 Chr12 26022922 26023496 25841227 25841531 305
132424_G8_OTH1225060 Chr12 26022922 26023496 26058615 26058919 305
132424_IR64_OTH1227180 Chr12 26022922 26023496 24939209 24939513 305
132424_R527_OTH1225630 Chr12 26022922 26023496 25264218 25264522 305
132424_R9311_OTH1235510 Chr12 26022922 26023496 25476923 25477227 305
132424_TM_OTH1221290 Chr12 26022922 26023496 25684785 25685089 305
132424_WSSM_OTH1223140 Chr12 26022922 26023496 25542750 25543054 305
132424_Y58S_OTH1225850 Chr12 26022922 26023496 26942379 26942683 305

>132424_R9311_OTH1235510
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.