Variation ID: 127742_125619_OTH1245410

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
26778614
26778918
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
127742_125619_OTH1245410 Chr12 25488377 25488951 26778614 26778918 305
127742_125827_OTH1246190 Chr12 25488377 25488951 26227141 26227445 305
127742_127564_OTH1239840 Chr12 25488377 25488951 25892080 25892384 305
127742_D62_OTH1226590 Chr12 25488377 25488951 25841227 25841531 305
127742_G8_OTH1237150 Chr12 25488377 25488951 26058615 26058919 305
127742_IR64_OTH1227840 Chr12 25488377 25488951 24939209 24939513 305
127742_R527_OTH1222510 Chr12 25488377 25488951 25264218 25264522 305
127742_R9311_OTH1212990 Chr12 25488377 25488951 25476923 25477227 305
127742_TM_OTH1239330 Chr12 25488377 25488951 25684785 25685089 305
127742_WSSM_OTH1228490 Chr12 25488377 25488951 25542750 25543054 305
127742_Y58S_OTH1241470 Chr12 25488377 25488951 26942379 26942683 305

>127742_125619_OTH1245410
tacgacgtacacatcgatctatacctctaacaagtccaaacatctactgtcacgctgtactctaccaacccaaacatgttccgacactacgtccgaagtaccgaaacacgaccgaccgcccttctgtacgacgtacacatcgatatgtacctctaacaagtccaaagacatgatacatgctagttctatcggcatgctgtactctaccaacccaaacttgttcggacactacgtccaaagtaccgaaacacgaccgatcgccctgctatacgacatacacatcgatgtatacctctaacaagtcc

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.