Variation ID: 127518_R9311_OTH1234720

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
305 bp
25476923
25477227
11
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
127518_125619_OTH1242020 Chr12 26349837 26350411 26778614 26778918 305
127518_125827_OTH1237170 Chr12 26349837 26350411 26227141 26227445 305
127518_127564_OTH1225130 Chr12 26349837 26350411 25892080 25892384 305
127518_D62_OTH1228980 Chr12 26349837 26350411 25841227 25841531 305
127518_G8_OTH1237820 Chr12 26349837 26350411 26058615 26058919 305
127518_IR64_OTH1234460 Chr12 26349837 26350411 24939209 24939513 305
127518_R527_OTH1231970 Chr12 26349837 26350411 25264218 25264522 305
127518_R9311_OTH1234720 Chr12 26349837 26350411 25476923 25477227 305
127518_TM_OTH1230280 Chr12 26349837 26350411 25684785 25685089 305
127518_WSSM_OTH1230290 Chr12 26349837 26350411 25542750 25543054 305
127518_Y58S_OTH1235520 Chr12 26349837 26350411 26942379 26942683 305

>127518_R9311_OTH1234720
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCC

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.