Variation ID: 117534_IR64_OTH1249900

Variant Type:
Ref Genome:
Query Genome:
Chromosome:
Ref Start:
Ref End:
SV Length:
Query Start:
Query End:
Allele sv Count:
308 bp
24939209
24939516
8
There is no gene in this region.
SV_id Chromosome ref_start ref_end query_start query_end length
117534_125619_OTH1244430 Chr12 25959742 25960178 26778614 26778921 308
117534_125827_OTH1252410 Chr12 25959742 25960178 26227141 26227448 308
117534_127564_OTH1247600 Chr12 25959742 25960178 25892080 25892387 308
117534_D62_OTH1242050 Chr12 25959742 25960178 25841227 25841534 308
117534_G8_OTH1248130 Chr12 25959742 25960178 26058615 26058922 308
117534_IR64_OTH1249900 Chr12 25959742 25960178 24939209 24939516 308
117534_R527_OTH1248710 Chr12 25959742 25960178 25264218 25264525 308
117534_Y58S_OTH1249490 Chr12 25959742 25960178 26942379 26942686 308

>117534_IR64_OTH1249900
TACGACGTACACATCGATCTATACCTCTAACAAGTCCAAACATCTACTGTCACGCTGTACTCTACCAACCCAAACATGTTCCGACACTACGTCCGAAGTACCGAAACACGACCGACCGCCCTTCTGTACGACGTACACATCGATATGTACCTCTAACAAGTCCAAAGACATGATACATGCTAGTTCTATCGGCATGCTGTACTCTACCAACCCAAACTTGTTCGGACACTACGTCCAAAGTACCGAAACACGACCGATCGCCCTGCTATACGACATACACATCGATGTATACCTCTAACAAGTCCGAA

Powered by

© 2021- Rice Gene Index @Zhang Lab. All Rights Reserved.

National Key Laboratory of Crop Genetic Improvement

Huazhong Agricultural University

Any comments and suggestions, please contact us.